AFT™ Linked-Reads Library Preparation kits
본문
|
NGS library preparation kits, Library의 구축을 신속하고 고효율로 실시 키트 AFT™ Linked-Reads Library Preparation kits
All steps of NGS library prep, including sample DNA Amplification, Fragmentation, and Tagging, are integrated into a single isothermal AFT™ step. As little as 6.6 pg of genomic DNA is sufficient for a perfect whole genome sequencing library. AFT™ technology tolerates inhibitory impurities from raw samples, enables library preparation directly from 0.1 μL of whole blood and environmental microbe pellet. Significantly, group of AFT™ amplicons share a common pair-end read, resulting from running-off amplification of a common mother amplicon, providing a native barcode to link all the daughter amplicons. The unique feature of linked reads facilitates the long scaffolding, de novo assembly, and haploid phasing.
AFT™ Linked-Reads Library Preparation technology combines the Amplification, Fragmentation, and Tagging of target DNA into one reaction, achieves unprecedented efficiency in DNA sequencing library preparation. It has three significant features: 1. Low DNA input, enables single cell library preparation; 2. Robust to inhibitory impurities in raw samples, enables direct whole blood and environmental samples library preparations. 3. More significantly, reads are linked by native barcodes, enables long scaffolding, de novo assembly, and haploid phasing without compartmentation.
AFT™ Linked-Reads Raw Blood WGS Library Preparation Kit의 예
AFT™ Linked-Reads Raw Blood WGS Library preparation technology utilizes multiple strand- displacement amplification by the strand-displacing enzymes to seamlessly integrate the Amplification, Fragmentation, and Tagging of the raw blood cell DNA into one reaction, achieves ultimate efficiency in animal DNA sequencing Library preparation from one tenth of a microliter blood.
Fig. 1. AFT™ primers are degenerate primers with 5’ tag of a fixed sequence. AFT™ primers randomly bind to multiple sites of the target DNA. Strand-displacing DNA polymerase initiates the amplification from AFT™ primers; the front amplicons are displaced by the running-up amplicons and in turn become template for next iteration of AFT™ amplification. The new amplicons all run off at the 5’ terminus of thetemplate amplicon and share the same sequence at 3’. In the pair-end sequencing, the common read serves as a native barcode to link all these that amplify from the same template amplicon.
As a unique feature, groups of AFT™ reads are linked by one common pair-end read that arise from the running off at the same terminus of the same template. The linked reads facilitate the long scaffolding, de novo assembly, and chromosome phasing.
Currently, no bioinformatics software package is provided to utilize the linked-reads feature.
AFT™ Linked-Reads Raw Blood WGS Library Preparation Kit seamlessly integrates the blood DNA extraction, Amplification, Fragmentation, and Tagging into one reaction, achieves ultimate efficiency in animal DNA sequencing Library preparation. All it takes is 1 uL of blood. The simple workflow comprises of 3 functional steps: blood cells lysis, AFT reaction of one hour at 45° C, and Library PCR of 16 cycles,there is also a SPRI beads-based purification before and after Library PCR step.
Answered Questions ;
Do I need to purify the blood cell DNA for AFT reaction? No. The strand displacing amplification of AFT reaction tolerates impurities in whole blood very well, but not well enough to take even 1uL of the whole blood as direct input, it however works perfectly with 1uL of 1:10 diluted in water.
At what temperature is the kit shipped? The kit is shipped on gel ice for within US and dry ice for international delivery. The kit should be stored at -20 °C on receipt.
Can I use 3rd party or homebrew index primer sets to amplify the library? Yes. If multiplexing, pick and record the index primers from index primer kits (third-party vendor, NEB E7600S, etc.). Be careful in selecting third-party index primers; some index primers are based on Nextera transposase recognition sites, not the standard Illumina Read1 and Read2 primer sequences. The correct index primer structures should be like below: P5(AATGATACGGCGACCACCGAGATCTACAC)-i5-Read1(ACACTCTTTCCCTACACGACGCTCTTCCGATCT) P7(CAAGCAGAAGACGGCATACGAGAT)-i7-Read2(GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT) Also, make sure the primers are at 10 uM concentration.
What’s the minimal length of the target DNA? 1,000 bp. Using DNA ladders that include fragments from 100 bp to 50,000bp, we found only when > 1,000 did the fragments get represented in the sequencing library generated by AFT™ Library Prep kit.
I didn't see the library smear The possible reasons could be: 1). The DNA might be degraded and reduced to less than 1 kb; AFT ™ technology prefers to work on DNA longer than 1 kb. Try to keep blood sample on ice or store at low temperature until the library preparation. 2). Excessive pipetting and vortexing during the workflow might reduce the target DNA to shorter than 1 kb, avoid excessive pipetting or vortexing. 3) When recovering the elution from SPRI beads, leave at least 3 uL behind, don’t try to recover all. 4). The third-party index primers are not compatible; some index primers are based on Nextera transposase recognition sites, not the standard Illumina Read1 and Read2 sequences. The correct index primer structures should be like below: P5(AATGATACGGCGACCACCGAGATCTACAC)-i5-Read1 (ACACTCTTTCCCTACACGACGCTCTTCCGATCT) P7(CAAGCAGAAGACGGCATACGAGAT)-i7-Read2 (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)
Cluster density was low White cell counts vary dramatically among individuals, try to run PCR with one or two more cycles.
PCR duplication rate is high The PCR duplication rate from AFT™ kit is normally very low, less than 3%, you may underestimate the input DNA amount and run PCR with too many cycles, try to use fewer PCR cycles, as long as the library has a molar concentration of greater than 1 nM for 250-500 bp range, it will be sufficient for a sequencing.
|
Ordering informations
|
Catalog No. |
Product Name |
Size |
|
6729001 |
AFT™ Linked-Reads Raw Blood WGS Library Preparation Kit |
24 rxn |
|
6729002 |
AFT™ Linked-Reads Raw Sample Metagenomics Library Preparation Kit |
24 rxn |
|
6729003 |
AFT™ Linked-Reads Single-Cell Whole-Genome Library Preparation Kit |
24 rxn |
|
6729004 |
AFT™ Linked-Reads Whole-Genome Library Preparation Kit |
24 rxn |
▣ 관련 페이지 ; FortiusSeq
댓글목록
등록된 댓글이 없습니다.



