Products

NGS library preparation kits, Library의 구축을 신속하고 고효율로 실시 키트

AFT™ Linked-Reads Library Preparation kits

All steps of NGS library prep, including sample DNA Amplification, Fragmentation, and Tagging,

are integrated into a single isothermal AFT™  step. As little as 6.6 pg of genomic DNA is

sufficient for a perfect whole genome sequencing library.

AFT™ technology tolerates inhibitory impurities from raw samples, enables library preparation

directly from 0.1 μL of whole blood and environmental microbe pellet.

Significantly, group of AFT™ amplicons share a common pair-end read, resulting from

running-off  amplification of a common mother amplicon, providing a native barcode to link all

the daughter amplicons. The unique feature of linked reads facilitates the long scaffolding, de

novo assembly, and haploid phasing.

AFT™ Linked-Reads Library Preparation technology combines the Amplification,

Fragmentation, and Tagging of target DNA into one reaction, achieves unprecedented

efficiency in DNA sequencing library preparation. It has three significant features:

1. Low DNA input, enables single cell library preparation;

2. Robust to inhibitory impurities in raw samples, enables direct whole blood and

   environmental samples library preparations.

3. More significantly, reads are linked by native barcodes, enables long scaffolding, de novo

   assembly, and haploid phasing without compartmentation.

AFT™ Linked-Reads Raw Blood WGS Library Preparation Kit의 예

AFT™ Linked-Reads Raw Blood WGS Library preparation technology utilizes multiple strand-

displacement amplification by the strand-displacing enzymes to seamlessly integrate the

Amplification, Fragmentation, and Tagging of the raw blood cell DNA into one reaction,

achieves ultimate efficiency in animal DNA sequencing Library preparation from one tenth of a

microliter blood.

Fig. 1. AFT™ primers are degenerate primers with 5’ tag of a fixed sequence. AFT™ primers

randomly bind to multiple sites of the target DNA. Strand-displacing DNA polymerase initiates

the amplification from AFT™ primers; the front amplicons are displaced by the running-up

amplicons and in turn become template for next iteration of AFT™ amplification. The new

amplicons all run off at the 5’ terminus of thetemplate amplicon and share the same sequence

at 3’. In the pair-end sequencing, the common read serves as a native barcode to link all

these that amplify from the same template amplicon.

As a unique feature, groups of AFT™ reads are linked by one common pair-end read that

arise from the running off at the same terminus of the same template. The linked reads

facilitate the long scaffolding, de novo assembly, and chromosome phasing.

Currently, no bioinformatics software package is provided to utilize the linked-reads feature.

AFT™ Linked-Reads Raw Blood WGS Library Preparation Kit seamlessly integrates the blood

DNA extraction, Amplification, Fragmentation, and Tagging into one reaction, achieves ultimate

efficiency in animal DNA sequencing Library preparation. All it takes is 1 uL of blood. The

simple workflow comprises of 3 functional steps: blood cells lysis, AFT reaction of one hour

at 45° C, and Library PCR of 16 cycles,there is also a SPRI beads-based purification before

and after Library PCR step.



Answered Questions ;

Do I need to purify the blood cell DNA for AFT reaction?

No. The strand displacing amplification of AFT reaction tolerates impurities in whole blood very

well, but not well enough to take even 1uL of the whole blood as direct input, it however

works perfectly with 1uL of 1:10 diluted in water.

At what temperature is the kit shipped?

The kit is shipped on gel ice for within US and dry ice for international delivery.

The kit should be stored at -20 °C on receipt.

Can I use 3rd party or homebrew index primer sets to amplify the library?

Yes. If multiplexing, pick and record the index primers from index primer kits (third-party

vendor, NEB E7600S, etc.).​ Be careful in selecting third-party index primers; some index

primers are based on Nextera transposase recognition sites, not the standard Illumina Read1

and Read2 primer sequences. The correct index primer structures should be like below:

P5(AATGATACGGCGACCACCGAGATCTACAC)-i5-Read1(ACACTCTTTCCCTACACGACGCTCTTCCGATCT)

P7(CAAGCAGAAGACGGCATACGAGAT)-i7-Read2(GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)

Also, make sure the primers are at 10 uM concentration.

What’s the minimal length of the target DNA?

1,000 bp. Using DNA ladders that include fragments from 100 bp to 50,000bp, we found only

when > 1,000 did the fragments get represented in the sequencing library generated by AFT™

Library Prep kit.

I didn't see the library smear

The possible reasons could be:

1). The DNA might be degraded and reduced to less than 1 kb; AFT ™ technology prefers to

     work on DNA longer than 1 kb. Try to keep blood sample on ice or store at low

     temperature until the library preparation.

2). Excessive pipetting and vortexing during the workflow might reduce the target DNA to

     shorter than 1 kb, avoid excessive pipetting or vortexing.

3) When recovering the elution from SPRI beads, leave at least 3 uL behind, don’t try to

     recover all.

4). The third-party index primers are not compatible; some index primers are based on

     Nextera transposase recognition sites, not the standard Illumina Read1 and Read2

     sequences.  The correct index primer structures should be like below:

     P5(AATGATACGGCGACCACCGAGATCTACAC)-i5-Read1

     (ACACTCTTTCCCTACACGACGCTCTTCCGATCT)

     P7(CAAGCAGAAGACGGCATACGAGAT)-i7-Read2

     (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)

Cluster density was low

White cell counts vary dramatically among individuals, try to run PCR with one or two more

cycles.

PCR duplication rate is high

The PCR duplication rate from AFT™ kit is normally very low, less than 3%, you may

underestimate the input DNA amount and run PCR with too many cycles, try to use fewer PCR

cycles, as long as the library has a molar concentration of greater than 1 nM for 250-500 bp

range, it will be sufficient for a sequencing.